• Omid Reza Zekavat, Seyed Javad Dehghani, Jaber Imanifard, Javad Dehbozorgian, Soheila Zareifar, and Sezaneh Haghpanah.
• a Hematology Research Center , Shiraz University of Medical Sciences , Shiraz , Iran.
• Hematology. 2017 Apr 1; 22 (3): 168-171.

Objective And ImportanceThalassemia is the most frequently monogenetic disorders around the world that is inherited as a recessive single-gene disease, resulting from mutations in α- or β-globin gene clusters. The aim of this report was to present a new insertional mutation in the α1 globin gene which causes transfusion-dependent anemia in α-thalassemic patients.Clinical PresentationTwo 5-year-old girls with blood transfusion-dependent α-thalassemia anemia and another girl with moderate α-thalassemia have been presented among patients who have been referred to Hematology and Thalassemia Research Center, Dastgheib Hospital, Shiraz, Iran. They were not relatives. All children were stunted and pale; they were put on regular blood transfusion every 14-21 days.InterventionSequencing of the β-globin gene was normal in all cases and their parents; but, α-globin gene sequencing results were remarkable. An insertion of 21 base pairs (IVS II+3ins (+21nt)(+GACCCGGTCAACTTCAAGGTG) in the α1-globin gene was detected in all three cases and one of their parents. In two cases, this insertion was accompanied by MED deletion and in one child by POLY A1 mutation. MED deletion was detected by gap-PCR.ConclusionThis new 21 base pair insertion cannot affect blood parameters on its own, but can present as continuous blood transfusion-dependent α-thalassemia. Thus, it is important to take this point into account for detecting the carriers, like β-thalassemia carriers, which can present as transfusion-dependent children in parents with α-thalassemia trait.

22 keywords...

hide…