• Medicine · Sep 2018

    Case Reports

    A novel 55-basepair deletion of hydroxymethylbilane synthase gene found in a Chinese patient with acute intermittent porphyria and her family: A case report.

    • Yi Ren, Lin-Xin Xu, Yun-Feng Liu, Chen-Yu Xiang, Fei Gao, Yan Wang, Tao Bai, Jian-Hong Yin, Yang-Lu Zhao, and Jing Yang.
    • Shanxi Medical University Department of Endocrinology, The First Hospital of Shanxi Medical University, Taiyuan, China Epidemiology Department, University of California Los Angeles, CA, USA.
    • Medicine (Baltimore). 2018 Sep 1; 97 (37): e12295e12295.

    RationaleAcute intermittent porphyria (AIP) is caused by hydroxymethylbilane synthase (HMBS) gene mutation.Patient ConcernsA Chinese female patient with very typical AIP symptoms of severe abdominal pain, seizures, hypertension, and tachycardia, accompanied with hyponatremia, anemia, and hyperbilirubinemia.DiagnosesShe was diagnosed as AIP based on positive result of urine porphobilinogen and her clinical syndrome.InterventionsThe proband was treated with intravenous glucose (at least 250 g per day) for 4 days. HMBS mutation was investigated in this family by Sanger sequencing.OutcomesA heterozygous mutation of the HMBS gene was identified in the proband and 7 other family members. Genetic sequencing showed a deletion of 55 basepairs (C.1078_1132delGCCCATTAACTGGTTTGTGGGGCACAGATGCCTGGGTTGCTGCTGTCCAGTGCCT) including the stop codon position, leading to frameshift mutation. The mutation has not been documented in current gene databases. Further prediction of mutated protein structure suggests that the mutation is likely to produce prolonged peptide with structural change and less stability.LessonsPhysicians should pay attention to AIP attack in patients with suspected symptoms and make use of genetic testing to increase identification of mutated HMBS gene carriers for further preventive strategy.

      Pubmed     Copy Citation     Plaintext  

      Add institutional full text...

    Notes

     
    Knowledge, pearl, summary or comment to share?
    300 characters remaining
    help        
    You can also include formatting, links, images and footnotes in your notes
    • Simple formatting can be added to notes, such as *italics*, _underline_ or **bold**.
    • Superscript can be denoted by <sup>text</sup> and subscript <sub>text</sub>.
    • Numbered or bulleted lists can be created using either numbered lines 1. 2. 3., hyphens - or asterisks *.
    • Links can be included with: [my link to pubmed](http://pubmed.com)
    • Images can be included with: ![alt text](https://bestmedicaljournal.com/study_graph.jpg "Image Title Text")
    • For footnotes use [^1](This is a footnote.) inline.
    • Or use an inline reference [^1] to refer to a longer footnote elseweher in the document [^1]: This is a long footnote..

    hide…

Want more great medical articles?

Keep up to date with a free trial of metajournal, personalized for your practice.
1,694,794 articles already indexed!

We guarantee your privacy. Your email address will not be shared.