• Medicine · Apr 2020

    Case Reports

    Targeted next generation sequencing revealed a novel deletion-frameshift mutation of KCNH2 gene in a Chinese Han family with long QT syndrome: A case report and review of Chinese cases.

    • Fengli Du, Guangxin Wang, Dawei Wang, Guoying Su, Guixiang Yao, Wei Zhang, and Guohai Su.
    • Institute of Translational Medicine, Jinan Central Hospital Affiliated to Shandong University.
    • Medicine (Baltimore). 2020 Apr 1; 99 (16): e19749.

    IntroductionLong QT syndrome (LQTS) is electrocardiographically characterized by a prolonged QT interval and manifests predisposition to life-threatening arrhythmia which often leads to sudden cardiac death. Type 2 LQTS (LQT2) is the second most common subtype of LQTS and caused by mutations in KCNH2 gene. Up to date, >900 mutations have been reported to be related to LQT2. However, mutational screening of the KCNH2 gene is still far from completeness. Identification of KCNH2 mutations is particularly important in diagnosis of LQT2 and will gain more insights into the molecular basis for the pathogenesis of LQT2.Patient ConcernsA Chinese Han family with LQTS phenotypes was examined.DiagnosisA novel deletion-frameshift mutation, c.381_408delCAATTTCGAGGTGGTGATGGAGAAGGAC, in exon 3 of KCNH2 gene was identified in a Chinese family with LQTS. On the basis of this finding and clinical manifestations, the final diagnosis of LQT2 was made.InterventionsNext-generation sequencing (NGS) of DNA samples was performed to detect the mutation in the LQTS-related genes on the proband and her mother, which was confirmed by Sanger sequencing. The proband was then implanted with an implantable cardioverter defibrillator and prescribed metoprolol 47.5 mg per day.OutcomesThis novel heterozygous mutation results in a frameshift mutation after the 128 residue (Asparagine), which replaced the original 1031 amino acids with 27 novel amino acids (p.N128fsX156).ConclusionThis novel mutation presumably resulted in a frameshift mutation, p.N128fsX156. Our data expanded the mutation spectrum of KCNH2 gene and facilitated clinic diagnosis and genetic counseling for this family with LQTS.

      Pubmed     Copy Citation     Plaintext  

      Add institutional full text...

    Notes

     
    Knowledge, pearl, summary or comment to share?
    300 characters remaining
    help        
    You can also include formatting, links, images and footnotes in your notes
    • Simple formatting can be added to notes, such as *italics*, _underline_ or **bold**.
    • Superscript can be denoted by <sup>text</sup> and subscript <sub>text</sub>.
    • Numbered or bulleted lists can be created using either numbered lines 1. 2. 3., hyphens - or asterisks *.
    • Links can be included with: [my link to pubmed](http://pubmed.com)
    • Images can be included with: ![alt text](https://bestmedicaljournal.com/study_graph.jpg "Image Title Text")
    • For footnotes use [^1](This is a footnote.) inline.
    • Or use an inline reference [^1] to refer to a longer footnote elseweher in the document [^1]: This is a long footnote..

    hide…

Want more great medical articles?

Keep up to date with a free trial of metajournal, personalized for your practice.
1,694,794 articles already indexed!

We guarantee your privacy. Your email address will not be shared.