• Medicine · Nov 2022

    Case Reports

    Inherited antithrombin deficiency caused by a mutation in the SERPINC1 gene: A case report.

    • Xinwei Hou, Kairu Zhang, Qian Wu, Mingyuan Zhang, Li Li, and Hongwei Li.
    • Department of Oncology, Haihe Hospital, Tianjin University, Tianjin, China.
    • Medicine (Baltimore). 2022 Nov 4; 101 (44): e31240e31240.

    RationaleInherited antithrombin deficiency (ATD) is a major cause of thrombotic deficiency. Genetic testing is of great value in the diagnosis of hereditary thrombophilia. Herein, we report a case of inherited ATD admitted to our hospital. We include the results of genealogy and discuss the significance of genetic testing in high-risk groups of hereditary thrombophilia.Patient ConcernsA 16-year-old male patient presented with chest tightness, shortness of breath, wheezing, and intermittent fever (up to 39 °C) after strenuous exercise for 2 weeks. He also had a cough with white sputum with a small amount of bright red blood in the sputum and occasional back pain.DiagnosesThe blood tests showed that the patient's antithrombin III concentration and activity were both significantly reduced to 41% and 43.2%, respectively. Enhanced chest computed tomography scans showed pulmonary infarction in the lower lobe of the right lung with multiple embolisms in the bilateral pulmonary arteries and branches. Lower vein angiography revealed a contrast-filling defect of the inferior vena cava and left common iliac vein. Thrombosis was considered as a differential diagnosis. His father and his uncle also had a history of thrombosis. The patient was diagnosed with inherited ATD. Further, peripheral venous blood samples of the family members were collected for whole-exome gene sequencing, and Sanger sequencing was used to verify the gene mutation site in the family. The patient and his father had a SERPINC1 gene duplication mutation: c.1315_1345dupCCTTTCCTGGTTTTTAAGAGAAGTTCCTC (NM000488.4).InterventionsAn inferior vena cava filter was inserted to avoid thrombus shedding from the lower limbs. Urokinase was injected intermittently through the femoral vein cannula for thrombolysis. Heparin combined with warfarin anticoagulant therapy was sequentially administered. After reaching the international normalized ratio, heparin was discontinued, and oral warfarin anticoagulant therapy was continued. After discharge, the patient was switched to rivaroxaban as oral anticoagulation therapy.OutcomesThe patient's clinical symptoms disappeared. reexamination showed that the thrombotic load was less than before, and the inferior vena cava filter was then removed.LessonsBy this report we highlight that gene detection and phenotypic analysis are important means to study inherited ATD.Copyright © 2022 the Author(s). Published by Wolters Kluwer Health, Inc.

      Pubmed     Free full text   Copy Citation     Plaintext  

      Add institutional full text...

    Notes

     
    Knowledge, pearl, summary or comment to share?
    300 characters remaining
    help        
    You can also include formatting, links, images and footnotes in your notes
    • Simple formatting can be added to notes, such as *italics*, _underline_ or **bold**.
    • Superscript can be denoted by <sup>text</sup> and subscript <sub>text</sub>.
    • Numbered or bulleted lists can be created using either numbered lines 1. 2. 3., hyphens - or asterisks *.
    • Links can be included with: [my link to pubmed](http://pubmed.com)
    • Images can be included with: ![alt text](https://bestmedicaljournal.com/study_graph.jpg "Image Title Text")
    • For footnotes use [^1](This is a footnote.) inline.
    • Or use an inline reference [^1] to refer to a longer footnote elseweher in the document [^1]: This is a long footnote..

    hide…